$PATH
module to temporarily load functions:
FastQC: quality control for .fastq files
sbatchapt-get and brew package managersapt-get or brew to install the sratoolkit on your local macine.bowtie2 binaries$PATHfastqc to check the quality of library or sequencing run.
Figure 1: pipeline flow chart
sshssh meds5420usrX@xanadu-submit-ext.cam.uchc.edu
sftpsftp meds5420usrX@transfer.cam.uchc.edu
srun --pty -p mcbstudent --qos=mcbstudent --mem=2G bash
Recall that you can use the command uname -a to get information about the achitecture of your computer.
We will download binary files for the popular alignment software bowtie2, using a Google search and a few clicks you should arrive here:
https://bowtie-bio.sourceforge.net/bowtie2/manual.shtml#obtaining-bowtie-2
click the Download link and arrive here:
https://sourceforge.net/projects/bowtie-bio/files/bowtie2/
Download bowtie binaries compatible with your architecture, in my case it is macos arm64. They go to my Downloads folder, so I can navigate there and unzip the file.
unzip /Users/guertinlab/Downloads/bowtie2-2.5.1-macos-arm64.zip
cd /Users/guertinlab/Downloads/bowtie2-2.5.1-macos-arm64
These are executable files, so we can invoke the software by just typing the full directory structure (or relative path) to the bowtie executable binary. I typically invoke the -h flag option when testing software, because it is usually the usage documentation or help.
/Users/guertinlab/Downloads/bowtie2-2.5.1-macos-arm64.zip
/Users/guertinlab/Downloads/bowtie2-2.5.1-macos-arm64/bowtie2 -h
MacOS does not like opening software from outside the AppStore, so you have to attempt to run bowtie and manually navigate to Security and Privacy to allow the developer.
Figure 2: tell your computer to trust the software
You do not want to specify the full directory structure to bowtie2 every time you run the software, so you can tell your computer where to look for any installed software. The computer needs to be told the $PATH where programs or commands should be found.
$PATHIn order to run a command from the terminal, the computer must know where the program is. You can do this manually, by specifying the full path to the program every time you use it. This is laboroious. To make life easier, each user has a ‘search path’ that tells the computer where to look for commands that are typed into the terminal. To view your path type:
echo $PATH
The search path is a list of paths that are separated by a colon. When you type a command the computer will look in each directory specified in the variable $PATH. If found, there is attempt to run the program. If not, you will get the error: command not found. To get your program to run, you can do any of three things:
1. Use the full path to the program when running it.
2. Move the program into one of the PATHs so that it is automatically recognized by bash.
3. Change the $PATH variable so that it includes the path to the program.
First let’s put the software in an appropriate place:
Many of the built in functions for your computer and some installed ones are in the /bin/ or /usr/bin/ directories.
For example try:
which python3
## /opt/homebrew/bin/python3
and
which grep
## /usr/bin/grep
which tells you where the program is, and these are indeed targets of the $PATH variable.
However, it isn’t a good habit to add custom installs to these directories because:
- Mistakes in altering directories with built-in functions can lead to corruption of core functions.
- it can be difficult to remove or alter your custom software in these directories.
There is another directory in the PATH that is convenient for custom installs by the user: /usr/local/bin/. It should be empty on new linux machines. One could move their bowtie2 folder contents to /usr/local/bin/ with mv. We could unload all the programs to the /usr/local/bin/ folder, but since other software will likely go here, things could get crowded. I like to keep them separate, by leaving programs from software packages in their respective folders and then just change my PATH variable to point directly to those folders.
Temporary path changes:
export PATH=$PATH:/Users/guertinlab/Downloads/bowtie2-2.5.1-macos-arm64
echo $PATH
## /Users/runner/Library/TinyTeX/bin/universal-darwin:/opt/gfortran/bin:/opt/homebrew/lib/ruby/gems/3.0.0/bin:/opt/homebrew/opt/ruby@3.0/bin:/Users/runner/.local/bin:/opt/homebrew/bin:/opt/homebrew/sbin:/Users/runner/.cargo/bin:/usr/local/opt/curl/bin:/usr/local/bin:/usr/local/sbin:/Users/runner/bin:/Users/runner/.yarn/bin:/Users/runner/Library/Android/sdk/tools:/Users/runner/Library/Android/sdk/platform-tools:/Library/Frameworks/Python.framework/Versions/Current/bin:/Library/Frameworks/Mono.framework/Versions/Current/Commands:/usr/bin:/bin:/usr/sbin:/sbin:/Users/runner/.dotnet/tools:/Users/guertinlab/Downloads/bowtie2-2.5.1-macos-arm64
The above command will add the directory where the bowtie2 binaries are to your $PATH. However, this is a temporary change that is only used for the current session. Thus, the altered path will be ignored when starting a new session. To make it permanent, you need to change the path in your bash profile
Your PATH variable is set inside your bash profile. This is a file called .bashrc (Linux) or .bash_profile (Linux or Mac). This file is located in your home directory, but is hidden from normal viewing. On Xanadu, I empirically determined that .bashrc is not used at login, so modify .bash_profile for software installed on the server.
To see your bash profile, move to your home directory and type ls -a. You can use nano to alter your path in the following way (you may need sudo):
nano .bashrc #.bash_profile on Linux
nano .bash_profile #.bash_profile on a Mac
Type this line at the end:
export PATH="$PATH:/Users/guertinlab/Downloads/bowtie2-2.5.1-macos-arm64"
This line overwrites the old PATH after appending the new path to the current PATH.
Save the file and exit nano.
Try to see what the new PATH looks like. NOTE: For the changes to take effect, you first need to start a new termial session.
echo $PATH
The new PATH destination should be reflected and typing bowtie2 from any directory should allow the computer to find it and print the usage to the screen.
Congrats, you have completed a custom install of software binaries and used a package manger to install software!
Installing from source is becoming less and less common as package managers are gaining in popularity. I tried to find a good example for you to install from source. I found that the most common tools sra-tools, bowtie2, meme, macs3, and bedtools all have different, sometimes complicated, and sometimes poorly documented installation instructions. The only general advice I have is to carefully read the README and INSTALL files.
Fortunately, most packages are available through package managers, preloaded in modules on the server, or available as binaries that are compatible for your system.
This link provides an explanation on what is happening during an install from source:
https://robots.thoughtbot.com/the-magic-behind-configure-make-make-install
module to temporarily load functions:We’re going to use the sratoolkit, fastqc, and fastx-tools amongst other things today and next time. These programs are on the server, however, we need to load them into our session for use. On our own machine we made sure the programs were in our $PATH. On the server we can use the module to load and have access to specific functions during your session without altering your $PATH. This provides flexibility and specificity in running software versions.
First, view which modules are available:
ssh <user_name>@xanadu-submit-ext.cam.uchc.edu
module avail
We can check specifically for sratoolkit:
module avail sratoolkit
Once you find the one you’re looking for:
module load <software>
This is convenient because you can add module functions to your shell scripts to be sure that you are using the correct software versions.
AND
You don’t have to waste time adding lots of programs to your $PATH
It is flexible because it allows you to even switch between version of software on the fly. For instance:
# load software
module load <software_v.2>
# do something
some commands, etc.
#unload software and load another version
module unload <software_v.2>
module load <software_v.1>
# do something else
more commands, etc.
& to the end of the command.To see what processes are running you can use several commands:
To stop runaway processes or ones that are taking too long in the background, you cannot use the normal Control-c. You can, however, scancel the process using the process ID number.
# when on the Xanadu server
scancel <process_ID>
You can also run jobs in the background on your own machine. In this case, you can use kill to cancel jobs.
kill <process_ID>
You can review other ways to view activities on the server and kill processes here: http://bioinformatics.uconn.edu/unix-basics/
prefetch: Downloads .sra file.
fastq-dumpvdb-validatefastq-dump: Downloads .fastq files.
vdb-dump --infofasterq-dump: Downloads .fastq files and automatically splits paired end reads
fastq-dump but enables multithreadingprefetchThis program directly downloads .sra files to you machine.
prefetch <options> <SRR-number> &
prefetch will typically add a folder called ncbi to your home directory, in which a copy of the sra file will be placed in the following location:
~/ncbi/public/sra/
You should first validate that the download is complete with vdb-validate:
vdb-validate <SRR-number>
sratoolkit maintains a database of checksums for each data set. This will essentially run a checksum on the file (in the ~/ncbi/public/sra/ directory tree) to confirm that the download was complete./
You can then use fastq-dump to convert the .sra file to fastq.
fastq-dump <options> <SRR-number> &
fastq-dumpThis program directly downloads .sra files to you machine and converts to fastq on the fly.
fastq-dump <options> <SRR-number> &
The data should be in whichever directory you specify (default is current directory).
fasterq-dumpThis program directly downloads .sra files to you machine and converts to fastq on the fly.
fasterq-dump <options> <SRR-number> &
The data should be in whichever directory you specify (default is current directory).
There are two data sets that we will practice with today.
Their accession #’s are:
SRR039637
and
SRR1552484
Create a /data/ folder within your home directory on the server.
Start an interactive session and load modules:
#start an interactive session
srun --pty -p mcbstudent --qos=mcbstudent --mem=2G bash
#load module:
module load sratoolkit
#change to /data directory
cd ~/data
Now let’s use prefetch and fastq-dump to download data.
prefetch: string together prefetch with validation and .fastq conversionprefetch SRR039637 && vdb-validate SRR039637 && fastq-dump --gzip SRR039637
fasterq-dump is quicker and it will automatically split paired-end files, but doesn’t include the option to compress:
prefetch SRR039637 && vdb-validate SRR039637 && fasterq-dump SRR039637
fastq-dump only:fastq-dump -F --gzip -X 20000000 SRR039637
# -F: downloads the original format of the data
# --gzip: compresses the data upon downloading
then use vdb-dump to get information about the file resulting from fastq-dump
vdb-dump --info SRR039637
Compare the number of sequences to number of lines in downloaded data. See how many lines there are in each file using zcat and wc.
Recall that zcat allows you to access gzipped files without actually uncompressing them completely. This can save a lot of time with decompressing/compressing large files.
Can you infer what the -X option specifies?
If you cannot retrieve the files, they are also in the data folder for our class: /home/FCAM/meds5420/data/
#For Linux (server)
zcat SRR039637.fastq.gz | wc -l
#On a Mac
gzcat -c SRR039637.fastq.gz | wc -l
You should get 23313288 lines.
For today’s exercises, we don’t need all the data, so let’s subset some of it into your home directory for practice.
Subsetting data is generally useful as it allows you to quickly do the following:
1. Get the general idea of how a dataset is constructed
2. Assess the quality of a dataset
3. Debug processing or analysis scripts
Using zcat again output the first 1000000 lines from SRR039637.fastq.gz into a new file called test1.fq and place it in your data folder.
Example:
zcat SRR039637.fastq.gz | head -1000000 > ./data/test1.fastq
Now go to your data folder and we’ll look at the data:
head -8 test1.fastq
## @HWI-EAS157_30FC5AAXX:4:1:988:1573
## GAAGCGGGTGCTCTTATTTTTCGTATGCCGTCTTCT
## +HWI-EAS157_30FC5AAXX:4:1:988:1573
## IIIIIIIIIIIIIIIIIIIIIEI=II@II3FIII3I
## @HWI-EAS157_30FC5AAXX:4:1:943:564
## GACCGCGTTGCCTATCGTATGCCGTCTTCTGCTTGA
## +HWI-EAS157_30FC5AAXX:4:1:943:564
## IIIIIIIIIIIIIIIIIIIIIIIIDIIIII5=II.?
.fastq files consist of 4 lines for each sequence. The lines are:
1. A unique identifier for that sequence
2. The sequence itself
3. Often a repeat of the unique identifier, but it can be anything
4. String of phred quality scores
What are phred quality scores?: They give the probability that the base call is correct. This convention was originally developed to aid interpretation of Sanger sequencing traces.
Figure 3: Sanger Q-scores from traces
The phred quality score (Q) is related to the log of the error probability (E):
Q=-10* log10(E)
This table shows the probabilities associated with different phred scores.
Figure 4: Phred interpretation
Illumina phred (Q) scores:
1. In current HTS data, the max quality score is typically 40.
2. These phred scores are represented by ASCII characters that put the scores into a single character per byte (or base).
3. The scores are typcially ASCII +33, in order to avoid odd characters and functions of the first 32 ASCII characters.
4. Illumina originally made their q-scores ASCII +64 so they would correspond to letters, however they switched due to pressure from the rest of the community (that already used ASCII +33).
You can check out the ASCII table here: http://www.asciitable.com/.
Figure 5: ASCII-Phred conversion
Two useful Quality control and read processing programs to use before mapping to genomes:
FastQC.
and
Fastx toolkit
Both programs are on the Xanadu server and can be loaded with module.
FastQC: quality control for .fastq filesPerforms moderately thorough QC and is extremely easy to use.
Concerns for QC:
1. Quality scores (Phred) for each base and average for reads
2. Adapter contamination (no DNA or RNA insert)
3. Duplicate sequences (library complexity)
4. Sequence lengths
Type of common preprocessing manipulations (fastx_tools):
1. Remove adapter sequences from reads (fastx_clipper)
2. Trim reads to a defined size (fastx trimmer)
3. View duplicate sequences (fastq_collapser)
4. Filter out low quality reads (fastq_quality_filter)
5. Filter out low quality portions of reads (fastq_quality_trimmer)
USAGE: For FastQC, it is simple:
#To Look at the usage instructions:
module load fastqc
fastqc -h
#To run an analysis
fastqc <data.fastq>
Helpful tip: Opening html files from command line.
FastQC creates individual files of the evaluation of each criteria. All of the results are viewable within a browser with the supplied HTML file. You can use the following command format to open fastQCreports.
open -a "/Applications/Google Chrome.app" <FILENAME.html>
However, I typically navigate to the directory and open the Finder.
cd </path/containing/the/html_file> # I am usually already there
open .
# OR
open /path/containing/the/html_file
I often have HTML files on a cluster and I do not view them remotely, so I use sftp to transfer them to my machine and open them locally. This is clunky, but it works.
Remember to use an interactive session when running these commands!
fastQC exercise:
1. Use the sratoolkit to download SRR1552484 to your data folder.
2. Write only the first 1000000 lines to a new file: call it test2.fastq
3. Go to the FastQC website. View reports from some of types of data (Good, Bad, Contaminated) under Example reports.
4. Run fastQC on the test2.fastq data as well as the test1.fastq data (from SRR039637 data we already downloaded).
5. View the contents of the resulting .zip file(s). All of these files can be viewed in the included .html file.
6. Open a new terminal window on your computer and use sftp or scp to copy the html link to your computer and view the report on a local browser.
Note: There is also a multiQC program on the server that you can use to compile all fastqc results from a single experiment together. This makes for easy comparisions between samples and/or replicates
To use it:
module load multiqc # load multiqc software
multiqc --help # view usage and option
1) Use the sratoolkit to download SRR1552484 to your data folder.
cd data
module load sratoolkit
fastq-dump SRR1552484 -F --gzip
zcat SRR1552484.fastq.gz | head -1000000 > test2.fastq
3-4) Run fastQC on the test2.fastq data as well as the test1.fastq data (from SRR039637 data we already downloaded).
module load fastqc
fastqc test1.fastq
fastqc test2.fastq
View the contents of the resulting .zip file(s). All of these files can be viewed in the included .html file.
Open a new terminal window on your computer and use sftp (or scp if you prefer) to copy the html link to your computer and view the report on the internet.
From your machine:
sftp meds5420usrX@transfer.cam.uchc.edu
get <path/to/html/file.html>